RBRC06459, C57BL/6J-Tyr<em2Utr>

RBRC No. RBRC06459
Type CRISPR/Cas9
Species Mus musculus
Strain name C57BL/6J-Tyr<em2Utr>
Former Common name Tyr G291T, B6-Tyr/G291T
H-2 Haplotype No Data
Background strain No Data
Appearance
1 Appearance No Data
Genotype No Data
Strain development Developed by Fumihiro Sugiyama, Laboratory animal resource center, University of Tsukuba in 2014. Generated by injecting Cas9 and gRNA (GGGTGGATGACCGTGAGTCCTGG) expression plasmids into the C57BL/6J fertilized eggs. Off-target analysis was examined.
Strain description Tyr 5 bp (291-5) deletion mutant mice (RBRC06458). Tyr G291T mutant mice (RBRC06459). Homozygous mutant mice exhibit albino phenotype.
Colony maintenance Homozygote x Homozygote [or Crossing to C57BL/6J(Crlj)]
Health Report No Data
Gene Details
Promoter No Data
1 Symbol Tyr
Symbol name tyrosinase
Chromosome 7
Common name No Data
Symbol description No Data
References

Research applications No Data
Specific Term and Conditions The following terms and conditions will be requested by the DEPOSITOR.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 system. Mammalian Genome, 25, 327-334 (2014).
Additional information
1 No Data
2 Genotyping protocol <PCR>
Depositor Sugiyama, Fumihiro (University of tsukuba) Sugiyama, Fumihiro
Strain Status /
Availability
(Expected delivery)


Sperm
Cryopreserved sperm : Within 1 month
Recovered litters from cryopreserved sperm : 2-4 months