Strain Information | |
---|---|
Image | |
BRC No. | RBRC09785 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | B6D2-Ddx3y<em2Osb> |
Former Common name | Ddx3y x/delta 6+delta 10 |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Ayako Isotani and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2014. BDF1 background. |
Strain description | Dbx3y mutant mice generated by the CRISPR/Cas9 technique. 6 bp and 10 bp deletion at exon 4. [Deleted sequence]: exon 4catgccctcatctcaatatcccataaggtacaacactaaaccagaatattaacaaagtacaagtcacgttttacttactgaaattttaaattgctaattattaaaagctgttgaaattttgtttgggtatccagtgtctatcactgtactgggatcagttattttagaagtctgtggcaatgaagagactttttgggttttgttctttttttccttgaaagGGGTCTGTGATAAGGA[CAGTTCAGGAT}GGAGCTGTAGTAAAGATAAAGATGCCTACAGCAGTTTTGGATCTCGTGATTCCAGAGGGAAGCCCAATTATTTCAGTGATC{GTGGAA}GTGGATCCAGGGGaaggtatattcttggttgataatgtacaaagtaatggttaagtatcttagtagttaagaatatgtaagaatcttaacttagcaaagtcagggttctcaaaactgatagaatgaatctgtctacctacttacctaagaatttactaattagagtggtgtacatgttgttgtccaactagtccaacaatggctatcc |
Colony maintenance | |
References | J. Reprod. Dev., 65(2):121-128 (2019). 30613052 |
Health Report | |
---|---|
Examination Date / Room / Rack | 2022/04/25Room:3-CRack:D |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Ddx3yDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linkedYDdx3y<em2Osb>endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University8030469F12Rik, D1Pas1-rs1, Dby |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9* (human codon-optimized), crRNA, tracrRNA, Mouse a part of Ddx3y gene.* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested. |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Reprod. Dev., 65(2):121-128 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen embryos Frozen sperm |
Strain Availability | Recovered litters from cryopreserved embryos (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |