Strain Data Sheet

RBRC09785

Strain Information

Image
BRC No.RBRC09785
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Ddx3y<em2Osb>
Former Common nameDdx3y x/delta 6+delta 10
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Ayako Isotani and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2014. BDF1 background.
Strain descriptionDbx3y mutant mice generated by the CRISPR/Cas9 technique. 6 bp and 10 bp deletion at exon 4. [Deleted sequence]: exon 4catgccctcatctcaatatcccataaggtacaacactaaaccagaatattaacaaagtacaagtcacgttttacttactgaaattttaaattgctaattattaaaagctgttgaaattttgtttgggtatccagtgtctatcactgtactgggatcagttattttagaagtctgtggcaatgaagagactttttgggttttgttctttttttccttgaaagGGGTCTGTGATAAGGA[CAGTTCAGGAT}GGAGCTGTAGTAAAGATAAAGATGCCTACAGCAGTTTTGGATCTCGTGATTCCAGAGGGAAGCCCAATTATTTCAGTGATC{GTGGAA}GTGGATCCAGGGGaaggtatattcttggttgataatgtacaaagtaatggttaagtatcttagtagttaagaatatgtaagaatcttaacttagcaaagtcagggttctcaaaactgatagaatgaatctgtctacctacttacctaagaatttactaattagagtggtgtacatgttgttgtccaactagtccaacaatggctatcc
Colony maintenance
ReferencesJ. Reprod. Dev., 65(2):121-128 (2019). 30613052

Health Report

Examination Date / Room / Rack2022/04/25Room:3-CRack:D

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Ddx3yDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linkedYDdx3y<em2Osb>endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University8030469F12Rik, D1Pas1-rs1, Dby

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9* (human codon-optimized), crRNA, tracrRNA, Mouse a part of Ddx3y gene.* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested.
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Reprod. Dev., 65(2):121-128 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP
Genotyping protocol -PCR-

BRC mice in Publications

No Data