Strain Data Sheet

RBRC09838

Strain Information

Image
BRC No.RBRC09838
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Del(74931431F19Rik-Ubqlnl)1Osb
Former Common nameUbqlnl-4931431F19Rik<+/-20770+1>
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Asami Oji and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. B6D2 genetic background.
Strain descriptionMutant mice generated by the CRISPR/Cas9 technique. 20770 bp deletion and 1 bp insertion at genomic region containing Ubqln3 at Chromosome 7. Del(74931431F19Rik-Ubqlnl)1Osb, [Deleted sequence], (Inserted sequence):ATTAACCTATGACCTCAGAACACAACACCTGC[AACAACGAAGGCCCGCAGGACCACTTGCCTGCCCTCACCT (total 20770 bp deletion and insertion of ‘G’) GGTAACCCTGCGTCCTCTTCTTCAGGAAATATGGCACGA]GCTAGGGAAGAAGCAGGGGACAGCCAG
Colony maintenance
ReferencesBiol. Reprod., 101(2):501-511 (2019). 31201419

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Ubqln5ubiquilin 57Ubqln5<Del(74931431F19Rik-Ubqlnl)1Osb>deletion, Chr 7, Research Institute for Microbial Diseases, Osaka University 14931431F19Rik

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Ubqlnlubiquilin-like7Ubqlnl

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), Escherichia coli ampicillin resistant gene, Streptomyces alboniger puromycin resistant gene, Mouse a part of Ubqlnl and 4931431F19Rik genes
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Biol. Reprod., 101(2):501-511 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP

BRC mice in Publications

No Data